Thursday, February 2, 2012

DASG (Digital Anonymous Study Genetics)




Nature has never intended to develop a human that will be plagued by illness and death. It is the human itself, which has been at the origin of almost all diseases.

The original document has been written on November 22nd, 2011.

To find the reason why all diseases start, we need healthy humans and because they do not exist, we are going to create them in a computer program. You might think that there are enough healthy humans, but when you look at their genes, you will notice that there are irregularities in the genes. These irregularities do not mean symptoms are present in the life of that person, but by evolution it can become problematic when that specific gene is fusing with another gene from the opposite partner. 


IMPORTANT: The computer program only works with anonymous information. This is especially important to prevent governments and other agencies in the future that would require an interface with other databases. Anyone who voluntarily cooperates with the permission of the DASG, has the assurance that his/her genetic information will be used only for medical research in this program.  The information that is used for this program is the genetic information and date of birth. It is not possible to update the information in any way identifiable. 


At the start of the evolution of the human, approximately eight million years ago, there were several places on earth where the human started its existence. These types were described as:

■ Caucasian (Aryans, Hamites, Semites)
■ Mongolian (northern Mongolian, Chinese and Indo-Chinese, Japanese and Korean, Tibetan, Malayan, Polynesian, Maori, Micronesian, Eskimo, American Indian) 
■ Negroid (African, Hottentots, Melanesians/Papua, “Negrito”, Australian Aborigine, Dravidians, Sinhalese)*. 

By getting more evolution in the world there will be people who say that there are no differences in human type, but I am convinced that there are differences in the DNA. Therefore I mention these different types of human.


The computer program will start with the type, Caucasian. We are going to search for 11 men and 11 women who are the age of 20-25 years old. This is done because, when necessary, we can get DNA information from the biological parents and even from the biological grandparents.  In some cases it can be helpful to find answers from the biological parents like Diabetes Type 1. The DNA of the 22 men and women will be set in the computer program and best is to start with the 11 men.


The data I am using is a theory at present, so scientists will produce the right figures and also assign the correct names to the genes. As known, a human has 23 chromosomes, which have a complete copy of that information, so we can say the human has 46 chromosomes. For the computer program however we only need 23.



We will set all chromosomes in the program, as shown on the image. It is clear that in this example, no information has been processed.

Here is a list of all chromosomes in the human body (approximately shown):

Chromosome 1 = 1.200 genes = 48.000 nucleotides
Chromosome 2 = 1.215 genes = 48.600 nucleotides
Chromosome 3 = 975 genes = 39.000 nucleotides
Chromosome 4 = 938 genes = 37.520 nucleotides
Chromosome 5 = 900 genes = 36.000 nucleotides
Chromosome 6 = 825 genes = 33.000 nucleotides
Chromosome 7 = 788 genes = 31.520 nucleotides
Chromosome 8 = 750 genes = 30.000 nucleotides
Chromosome 9 = 675 genes = 27.000 nucleotides
Chromosome 10 = 750 genes = 30.000 nucleotides
Chromosome 11 = 750 genes = 30.000 nucleotides
Chromosome 12 = 675 genes = 27.000 nucleotides
Chromosome 13 = 600 genes = 24.000 nucleotides
Chromosome 14 = 525 genes = 21.000 nucleotides
Chromosome 15 = 495 genes = 19.800 nucleotides
Chromosome 16 = 450 genes = 18.000 nucleotides
Chromosome 17 = 413 genes = 16.520 nucleotides
Chromosome 18 = 375 genes = 15.000 nucleotides
Chromosome 19 = 300 genes = 12.000 nucleotides
Chromosome 20 = 300 genes = 12.000 nucleotides
Chromosome 21 = 225 genes = 39.000 nucleotides
Chromosome 22 = 225 genes = 39.000 nucleotides
Chromosome 23 for the woman (X) there are between 900 and 1,200 genes (x40 = nucleotides)
For the man (Y) there are between 46 and 375 genes (x40 = nucleotides)

To start making a healthy human in the computer, we only work with the first 22 chromosomes. We start at chromosome 1 with gene 1. To get the information relative to the 11 men, we will work with colored labels. But first we have to give the 11 men a code, which is linked to their DNA information.

The man is X and the woman is Y. When their genes fuse you get a child which is the letter K. The name is the age of the person indicated, a serial number, year of birth, date of purchase genetic material and then the race.

For instance: Y AAAAAAAAAAAA001-22-1989-20111115-CAUCASIAN
The number changes as follows: AAAAAAAAAAAA001 AAAAAAAAAAAA002 ...
AAAAAAAAAAAA999 AAAAAAAAAAAB001 etc.

When all genes – from the 11 men – are equal, the color of the gene is green.

When with a maximum of 2 out of 11 men the gene is different, those two genes are colored yellow and in total the gene is yellow, which has the opportunity to color green in a later stadium. This can be possible when the same gene at the women is green. Will give an example here:

11 men:
AAAAAAAAAAAA001 Y-22-1989-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA002 Y-21-1990-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA003 Y-23-1988-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA004 Y-23-1988-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA005 Y-25-1986-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA006 Y-20-1991-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACTAAGGGGCCCGACGGAC
AAAAAAAAAAAA007 Y-22-1989-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA008 Y-23-1988-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA009 Y-25-1986-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA010 Y-20-1991-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC
AAAAAAAAAAAA011 Y-24-1987-20111115-CAUCASIAN
ACGTAGGACTTAAGGGCGACGACAATGGGGCCCGACGGAC

As we can see in this sample there is one man having another gene information. When we compare this information from all the 11 men with the information of the women and their information is all equal the end result for this gene is green. In the label however it is possible to see the yellow one, which is different. 

When you go to gene number 2 in chromosome 1 and the same man has a different gene, than you might consider to add another man to this group, which has the same gene information as the rest of the 10 men on 1 and 2.

It certainly will happen that in a gene more men have different information. When this is on 11 less than half of 10, a colored label can be made of orange. The color of the total gene also can become green when most men and women have the same gene information.

And of course there are also genes that are different, because they have influence on the color of the eyes, hair, etc. Then the color of the total gene is red. Another sample here:

When all 22 chromosomes of the men are compared and set in a new basic man, we do the same with the 11 women. Then we compare the basic man and basic woman, to get a complete basic human, without chromosome 23. In all the genes we still can find the original information of the 22 men and women. This can be helpful for upcoming research on diseases. 

As we know, men have less 23 genes in chromosome  than women, but still it is possible to create a healthy gene. As said before, a man has between 46 and 375 genes in chromosome 23, while a woman has between 900 and 1,200 genes. 

It is understandable that the information for men and women can be compared separately and complete the basic healthy man and basic healthy women, which we will set in the computer program as:

AAAAAAAAAAAA000 Y-00-0000-20111115-CAUCASIAN
AAAAAAAAAAAA000 X-00-0000-20111115- CAUCASIAN


RESEARCH DIABETIC TYPE 1
To find out what occurs with the genes when a young person is getting Diabetic Type 1 we can apply some research. First of all we are going to ask for the genetic data from that person and also from their biological parents. Of course anonymous rules are applied here.

The information about the person and his parents is brought in, into the computer program. As said before the biological father is Y, mother is X and the young person is K. A fusing of Y and X in the computer program should give the result of K. If not, you already will have a clue to figure out why the result in K isn’t fused between X and Y. 
It is also possible now to fuse the healthy digital man with the biological mother; the healthy digital mother with the biological father. Is the result the same as from K? 
The computer program will discern what genes are causing problems.

If the cause of the problems is determined, it is possible to find a solution with the help of stem cell therapy. A less expensive method is to correct a cell with the wrong combination of nucleotides and implant them by injection. The territory, which must be handled, can have an incentive with my GH-method.  I will give more information about that only to serious scientists / universities. 

The computer program with information about the healthy man and woman can be used for many other forms of research. It can examine basic men and women with other ethnic backgrounds. Then it is possible to research what occurs if you fuse different ethnic backgrounds. 

*These figures are from a publication on the Internet: blog.world-mysteries.com. Dated February 18, 2011


Update 20150114: New test at RUG Groningen (Dutch)